Primers used to sequence ATP6, ATP8, and ATP9. These primers can be used to directly sequence mt DNA isolated as described on the prior page. The mtDNA concentration should be from 1-2 mg/ml in water. The mtDNA was sequenced at the U. of Chicago DNA sequence facility (http://cancer-seqbase.uchicago.edu/). Make a note to the facility that the DNA is from the mt genome and specify the size. The large form is about 95kb. The DNA sequence facility needs to alter their parameters to sequence using the mt genome as compared to purified plasmid preparations.

............................................................................................................Tm .................Position r/t AUG of ORF
1. atp6_56.pri........ TCACCATTAGATCAATTTGAGATTAG ........51.1oC ..................+56
2. atp6_245.rev.pri ........ACCTCCAATTTGTCCTTTAAGC ...........53.3oC................. +245
3. atp6_488.rev.pri........ GGTAATGGTGTACCAGCAGG ...............54.4oC ................+488
ATP6 ORF 28487 to 29266 (YGDB) 779bp

4. atp8_F.pri ........ATAGTGAACCCCGAAAGGAG........................ 54oC ....................-350
5. atp8_R.pri ........GCCGGACTATAAGAATTTT .............................47.2oC................ +470
ATP8 ORF 27666 to 27812 (YGDB) 146bp

6. atp9_F.pri .........ATAAAATTTATAGTTCCGGG.......................... 44.9oC................. -400
7. atp9_F2.pri....... AAGTCCCTTTTTTTTTATTTAAAATAAAG .....49.0oC............... -188
8. atp9_R.pri......... CCCGAAAGGAGATGTTCACT ........................54.5oC................ +762
ATP9 ORF 46723 to 46953 (YGDB) 230bp